header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-131220-345
Genomic Feature: sa22216
Synonyms:
Affected Genomic Regions: aifm2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 7243103 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GGATGCGTTTCATCACAACGTTGCAGCTCTGCGTGCCTCAGTGCAAACTG
G/A
TAATGCAGTAATCACCATAATCAGAACAGCAAACATCCTGATAAAACTTA
(1)
OTHER sa22216 PAGES
ZMP:sa22216 (1)
GENOTYPES No data available

CITATIONS  (1)