ZFIN ID: ZDB-ALT-131217-16616
Genomic Feature: sa22610
Synonyms:
Affected Genomic Regions: itgae.2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 17178490 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
AATAATAATATATGAATCAATATTACAAAAGCAATAGGTTTTATGTAAAATAATTCACAGGTTGTTTGTTTACTCACCCACGTATAAGAATTGGTAGGAAATACATCACATTAAACGTATATATTCTAGAGTCCAGAAGCTGAATGCCATTATTCTGACTAAAAAAAAGAAAAATAAACAATAAAAACAGATGAAATACTATATTCAGATGTTCAAAAACCAGAGTAATGTTCAAGCCAGCATTCAAACCTGGTAAGATTTGCTATAATCTCAGACTTCTTGAGATCAGATTTGTCATTAAGTTGCCAGGAGATGAAGAGATTGGTCTGGAAAAATAATTAACAAAATAAATAAAACAAAAGGTACAAATGAGAATGGTAATATTTCAAAGATGTGATGTGAGATTTTTTACCTGTGCAGATCTTGTGAAAACCGGGTGTTGAAGATGACACTGAATCTGATTGTCATTCTTCACAGGACAGGCGGCTCCTTCAATTTTC
T/G
GTTTGCAGAGCACAGTTCGTCAGGACTCTCTGTTAAATGCAACTGTGAGAAGAGCTGTGAGTGTTTTTTTTTTTTACCCTCTCACTGAGTATGCTGGGGTACGTCAACGTCAGGGTGGTCTTGTAGGAAGGGTCTCCAGTGTTGGTGAAATTGAAATTGATATTCAGGTTTTGCGTTTCTCCCATTGTGATAGTGGTTTCACTGCAATATTAATATACATTTAGTTACAAGAAAATATATACTTTTACATGTCTTATAAATACGTACACTCCTAAAACGGAAATGAAGTTAACTAGATAAAGACTAGAATTTGATCAGTACGTACCTTATTTTTGAATCAGATAATGTAATGCTAGGTTTACAATCTGCAGCCTGGCAGTCCTTTTCAAATGGAATCTAATGAAAACAAATTGAAATTTCTGATCATTTACTAAGTCATTGGTAACACTTCATGATACAGGACATTTACTGTTAGTTATTGTTTTTACTAACACAAACAC
(1)
OTHER sa22610 PAGES
ZMP:sa22610 (1)
GENOTYPES No data available

CITATIONS  (1)