ZFIN ID: ZDB-ALT-120727-58
Genomic Feature: sa1758
Synonyms:
Affected Genomic Regions: zgc:113274 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 10: 5144346 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GACCTACGAGGAGCTGGAGAAAGCATTCGTTGAGGTGAAGCGTGGGAAATCGATCCGAACAGTGGCGAAAGAAAGAAAGATCGGCAGATCCACACTGCAGAGATACATGAAGAAGGCCGAAGAAAGAAGAGAGAGAACTGTGGGCTACAGAGGAACGGCAGAAGCCAAAAGGATCTTCTCTGAAGAACTGGAGGAAGAGCTTGCAGAAAACATCCGCATAATGTCTGAACGCGTCCGTGGCCTCGCAACAAAGAAATGCAGAGAAATCGCTTTTGAATTTGCACAAAAACACAACATTCCTGTCCCTAACAATTGGGGAGAGCAGAGGTTAGCAGGTAGGTTCGGTTGTGACAGCTTAATTCGGTAATTCAGTCCATTCTGTGTTGGATAACTTGAATGTTTAACTCTTTTAGGTCGAGACTGGCTGAGTAGCTTCATAAACCGCCACAATCTCTACGGCCATCTTACTGAAGCAGCGTCTTTGGAAAGTCATGGACAGG
T/C
GACAGAGCCAACATTTTTCACTAAATGAAAGTTCCTGCAGTCATGGAAAAATTGGGCTTTCAGGATTGTGATTTCCAGCCCTGAGAATATAGAAATGTATACAGTCAGTGAGCAATCATTAGTAGTTTATTAGAAATATTCCAGTGTTTATGTAAAAAAGAAACACCATGATATAAAGAGGTAGGCCAATGAAGCTAAATGCTGGCCAATTTAGGCCCTGTCCACAGAAACATGGGTATTTTCAAAACCGCACTTTTGGTTTTGCGGTTTGGCTGTTTGTCCGCACGTGTGGTCCAAACAGTCTGGTCATGTGGACGCTAAAACCGGAGTTTTAGGGTGTACTCACACTATGTACAGTTGATTTGAACCAGGCTGAAGCATGCTTGTCTCCCCCGACGGCCCGCACAAACATTACATTCGGGTATGTGCACGCTGACATCCTCGATGATGTAAGCAATTTCGCTCAGCACAGTGGAGATTTCTTTAGTTATTTTGTTTTA
(1)
OTHER sa1758 PAGES
ZMP:sa1758 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous zgc:113274sa1758/sa1758 (TL) zgc:113274 ♀+/- ♂+/-

CITATIONS  (3)