ZFIN ID: ZDB-ALT-120727-267
Genomic Feature: sa2365
Synonyms:
Affected Genomic Regions: unm_hu7910 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 58205421 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GAATACACCTGTTTGTAGCGCAAGTAGCTTGACCTTATTCTGCCATTTATTATTTCTAGTCATTTCTCCCATAGGGCAACTGATTTGGAAGTTCTAAAACAAATCGCAAAAACTAGTGCACTTCCACATCACAGAATAAGGTCAATAGATATCCTTAAAACTAGCATCTAAAACTAGCATCTTTCTAACATCTAAACAATCTTATTATTTCACAGGACCTTTAACAATTGGATTTCACCATAGCTAGATGGCACATTAATGTTTAAAATATGTACCTAGAAACTGCTGCCTGTCTGCCCGTCTCTTCAGTGTGGCTTTGATGAGGTCTGGTGGAACATCTGGGAGCTCGGCTACTTCTCTGTATGTGTTCACCGCCTTCAGCAGCATCTCATTACTGCGCTTTTTCTCTGCCAAATCATCTTCAGCCTGAACACATGTTTATGAGTGCTCATAATATAACATAGACACATCAGCATTGCAACCTTTTATGATAATGTGTT
A/G
CCTGTGCTTTACCGTATCTGCACCTCGGACTATGTGGAAATTTCTGCACAAGATCTTCAAAAGCCTGCAGAGACTCCTCAACCTTTCCCTGAAGACAAAAAGACTATTAATTCTGTCTGCAAATTTTTACTAATCATATTTTATTTGTGCTGTAACAGAGCATCATTTTTGTATACATTTTACCTTCTTCCGTAGTTTCTTTGCAGAGTTGATTTCCGATTTGATTGTTTTGTCAAATTTATTAAGGAGCTTCGGTTTCTTCGCTTTGGCTGTAAGAGAATTCACCACAGCATAAGTCTTTCTTGAAGTGTTGTGCTTTTCACACAATATCAATTCCATACAAATCATCTTAAAAATGCTTGAGCAGAGACAAATGTAGGTTGAATTGTTCTTACAAACTTGACAACTGTGGTTTTGTGGTGCTATTACGATATTTTAAGTTGTCTGGTGTCCTACTTAGGTAAAATTATAGGTCGAATTTATAAAGTCTGATTAAAAAT
(1)
OTHER sa2365 PAGES
ZMP:sa2365 (1)
GENOTYPES No data available

CITATIONS  (1)