ZFIN ID: ZDB-ALT-120727-224
Genomic Feature: sa913
Synonyms:
Affected Genomic Regions: krt1-19d (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 5331079 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATCATTCATGGCCAGACTGGTGTTGTCGATGCTGAGATGGAGTCCACCCT
T/A
CAGATGAATGGCTGCCATGATCTGGAGAAACAAATAAACTAAAATGACTT
(1)
OTHER sa913 PAGES
ZMP:sa913 (1)
GENOTYPESNo data available

CITATIONS  (1)