ZFIN ID: ZDB-ALT-120727-218
Genomic Feature: sa905
Synonyms:
Affected Genomic Regions: plcxd3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 31851526 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TTCAAGCTTCAGTAAAGGATCGGAGACGTAAGGGCACCTTTTTTGTGTCC
C/T
AGGTGGTTCTTACTCCAAAAGCAAGCACCGTCATGAAGGGAGTCACCAGT
(1)
OTHER sa905 PAGES
ZMP:sa905 (1)
GENOTYPESNo data available

CITATIONS  (1)