ZFIN ID: ZDB-ALT-120411-561
Genomic Feature: sa2293
Synonyms:
Affected Genomic Regions: sfi1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 40907722 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATCCTTGACAGGTTTGCATAGCGCACGCTGCTTCCATCGAAGAGCGCATC
G/A
CCTCACCACCTCCTGAAGCTGACGACAGCTCTGTACAGTATGCAGATTTC
(1)
OTHER sa2293 PAGES
ZMP:sa2293 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous sfi1sa2293/sa2293 (TL) sfi1 ♀+/- ♂+/-

CITATIONS  (3)