ZFIN ID: ZDB-ALT-120411-558
Genomic Feature: sa179
Synonyms:
Affected Genomic Regions: epor (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 14560552 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CCCATTAGACGAGAGGAAGCTTGTGCGGGACGAGGACCAGCGTTCAGACT
C/A
GGGGCTGACAGAGCCTCCTCATTGGCTCATGGAGCAGCTGAGGGCGCTTC
(1)
OTHER sa179 PAGES
ZMP:sa179 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous eporsa179/sa179 (TL) epor ♀+/- ♂+/-

CITATIONS  (3)