ZFIN ID: ZDB-ALT-120411-496
Genomic Feature: sa926
Synonyms:
Affected Genomic Regions: map7d1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 3945809 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AAAATCACTCTTATAAGTGGTTTAAACACAGTTGTGTGGCAGCAGTCTGTGAATATATCATCTAAAAGAAACACTTTGATTGACATTCTCCCTTTGTACGTGTCACTAGAAAGGGGAAAGCCCCGCCCACTAGTGACAATCTCTCCCAAATTAGCATAGGACGTTAGTCTTGTTTGTGAATCTGCCACTATGCTGGCACGCATTTGTAGCTCCGCCTTCTTTTAAAAAGAGCACAATCTCATTTGAATTTAAAGCGACAGTCACTAAAATGGCACATTAGAATCAAAAGGAACAGTTTCAAAGAGTTATAAAACATTATCAGTGTGATATTTTAAGCTAAATCTTCACACTCTAGGGACATCAGAGACCTATTTTACATTTTATGTAATCAGTGTGGTGTGTGTGTAACTCACGGGGGTCGCTGCTGTTCTGCAGGGTGGCGACGCTGCGGCTGCGAGCCAGAAAGGAAAGGGTAGGCGTCATCAGTCGCTCCACGATTC
G/A
ACTCTCCCACGGGCTCAAGCGCAAACTGCGGGCTGACACAAGAGGGTGCTGTTAACATCAACATATGCTGACACAAACCACAGGTCACTGGACAAAGGGCCAATCAGCAGGCTGTAGCAGTGCTGCTAGACAAATCAGAGCAGCCGTTACAGGAAGCAGACTTATCAGGCCCTTCGTTGAGTGAACACTGATCCTTTTCTTGATCTGGACTCATTTCTGGACACTACAGTAAATATTAGTGAATGCTGTAGTGGTTTACGTACACTCATATGTTTGCTTTGTCTGTTTGATGTAACTCAAGAGAGTTAAAGTACAACTTAGTGTATTTAAGTAGTACTCAGTATTTACTCATGCTGTTTAACTTGAAAAATGTTGCTATTTTACACACACACACACACACACACACACACGTGTAGAACTATCTTTATGGGGACTTCCCAAAGACATAATGTTTCTACTGTACAGACTGTAAATTCTGTCCCATTATTTCTAATCCCAAC
(1)
OTHER sa926 PAGES
ZMP:sa926 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous map7d1bsa926/sa926 (TL) map7d1b ♀+/- ♂+/-

CITATIONS  (3)