header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-397
Genomic Feature: sa466
Synonyms:
Affected Genomic Regions: pknox2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 10: 31027157 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAAGAGCCAGGAACGCATAATGTTTGTGGCATGTTTGGGAAGGACGCCTC
T/A
TTTGTTTTTTGATTTCTTGTCATCGCCATCCAAGAGTGAGGACAAGTCCA
(1)
OTHER sa466 PAGES
ZMP:sa466 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pknox2sa466/sa466 (TL) pknox2 ♀+/- ♂+/-

CITATIONS  (3)