ZFIN ID: ZDB-ALT-120411-364
Genomic Feature: sa393
Synonyms:
Affected Genomic Regions: sytl1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 42583675 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATATGAATGAAAGAGAGGACGATAAGCATCAGGAACAGAAGGAAAGCGGA
C/T
AAGAAGATGGGGAAAGGTTGGTGCAATTTTTGTTTGTAATCTTTATTGCT
(1)
OTHER sa393 PAGES
ZMP:sa393 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous sytl1sa393/sa393 (TL) sytl1 ♀+/- ♂+/-

CITATIONS  (3)