header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-140
Genomic Feature: sa1382
Synonyms:
Affected Genomic Regions: cyp2aa6 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 42324802 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GGAAATCATAAAAGAAAACATCATTCAGGCAGGATCACTTGTTGGACAGG
T/A
ATGGAAAGATGACAAATATTTCACAAGATGTCCAAACTGATCCTATAGTT
(1)
OTHER sa1382 PAGES
ZMP:sa1382 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cyp2aa6sa1382/sa1382 (TL) cyp2aa6 ♀+/- ♂+/-

CITATIONS  (3)