ZFIN ID: ZDB-ALT-120411-106
Genomic Feature: sa1335
Synonyms:
Affected Genomic Regions: slc4a5a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 28066198 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GGGCGGGGCTATGTCAGCTCAGCATCGTGAAGTTTTGGCCATCGGCGATGGTCGATGACATTGTCTATCAGCCCAACCCAACCTCCGATGACATGTACAAGGAAGAAACTCAAAATAAAGTGTCTCTGTAGACTCTTTTTTACAGTGTGAGATTATAAAAAAACAGCTTAACCCCCTTATAAAATATTTTTGAATATTAGGTCCCCTTTAAAATAGCAGCAAACTGCATGGAGACCTTTAACTTGTTTTCCTTCCGGTTGACGATAACAGCGCTGATCTGCTGATCCATGAAGATAAGGATGGTGACGAGGAGAGCAGGGACGAAGCTTGCCAGGTAAACCCACCATGGATTCTTTCCAAATGGCATCACAAACCATCCTCGGTCAGGACGTGTGGGCTACATGATTGAAAAAAAAATAAAACAAAACAATGTGTTGGAATAAAATTATAAGGAACTTCATTGAAAAAGTCACACAACATCAACCTAATTTATACTCTCA
C/T
CTTGAACTCGGTAGGCACAATGAGTTTGGGTGTTTTCAAACCTATTAGCATGTCCAGACCCACAAACGTCATGATGGACATGAAGATGGAGAAGTCACTAATTAACTTCCTCAACTGGATAGACAAAAAAAAAAAATAGGTATTTTATTAAATATGAATTAGACATGTAGTTGCAGCTTCAGAAATATAGCAGCACAGTGTTGCTAAAGAGCTACATTTTTTCCTGAACCCCATAATGCTTTGCGTGGATTATAGGAGTATCTTCCAATAAACTCTAAACAATCAGCAAAGGGTTTTAAAGGAGTGTGATCAATGAGCTGTCCAGTATATCCATCCATTTTCAAAAGGAAAGCTATTATTTAACAAATGACTTTCAGCAGACTATGAATAAACCCAAAATCTCAAAACAAGAATTTCCACAGCAATTTTACACACTTAAATGTAATATTACAGTTGGGAATACAAAGAGAAAATAATCTTTAGAAACAAATTACAATGAA
(1)
OTHER sa1335 PAGES
ZMP:sa1335 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous si:ch211-48m9.1sa1335/sa1335 (TL) slc4a5a ♀+/- ♂+/-

CITATIONS  (3)