header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-090220-2
Genomic Feature: sa102
Synonyms: sa0102 (1)
Affected Genomic Regions: canx (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 16456711 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGGTGTTGAAATCCAAAGCCAAGCACCATGCCATCTCTGCCCTCCTACTG
C/T
GACCTTTTACCTTTGACACCAAACCACTCATTGTCCAGTGAGTATTCATG
(1)
OTHER sa102 PAGES
ZMP:sa102 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous canxsa102/sa102 (TL) canx ♀+/- ♂+/-
Heterozygous canxsa102/+ (AB) canx Unknown
Unknown canxsa102 canx Unknown

CITATIONS  (7)