header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-080929-1
Genomic Feature: sa91
Synonyms: sa0091 (1)
Affected Genomic Regions: tshz1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 19: 21410482 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTCCAATACACCCCTCCATTATGGATGATCGGAAGGAGTTGGAAGAAGAG
A/T
AATTTGAGGAACCTGAGGAAAAGAAAATCAAGCAAGAGAAGGAAGACCCT
(1)
OTHER sa91 PAGES
ZMP:sa91 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tshz1sa91/sa91 (TL) tshz1 ♀+/- ♂+/-
Unknown tshz1sa91 tshz1 Unknown

CITATIONS  (6)