Morpholino

MO1-twsg1b

ID
ZDB-MRPHLNO-050119-5
Name
MO1-twsg1b
Previous Names
  • MO1 (1)
  • MO1-tsgb (1)
  • tsg1-MO (1)
Target
Sequence
5' - CTGATGATGATGATGAAGACCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-twsg1b
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Xie et al., 2005
Fig. 1 with image from Little et al., 2004
chrd Fig. 5 with image from Xie et al., 2005
efnb2a Fig. 1 from Esser et al., 2018
egr2b Fig. 5 with image from Xie et al., 2005
Fig. 1 with image,  Fig. 3 with image from Little et al., 2004
ephb4a Fig. 2 from Esser et al., 2018
eve1 Fig. 5 with image from Xie et al., 2005
Fig. 6 with image from Little et al., 2004
foxb1a Fig. 6 with image from Little et al., 2004
gata2a Fig. 5 with image from Xie et al., 2005
gsc Fig. 5 with image from Xie et al., 2005
myod1 Fig. 5 with image from Xie et al., 2005
Fig. 1 with image,  Fig. 3 with image from Little et al., 2004
pax2a Fig. 1 with image,  Fig. 3 with image from Little et al., 2004
Phenotype
Phenotype resulting from MO1-twsg1b
Phenotype Fish Figures
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b Fig. 2 from Esser et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO1-twsg1b Fig. 1,  Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-twsg1b Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO1-twsg1b Fig. 1 from Esser et al., 2018
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO1-twsg1b Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO1-twsg1b Fig. 1 from Esser et al., 2018
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-twsg1b Fig. 8 with image from Heinke et al., 2013
intersegmental vein malformed, abnormal y1Tg + MO1-twsg1b Fig. 8 with image from Heinke et al., 2013
posterior caudal vein malformed, abnormal y1Tg + MO1-twsg1b Fig. 8 with image from Heinke et al., 2013
sprouting angiogenesis process quality, abnormal y1Tg + MO1-twsg1b Fig. 8 with image from Heinke et al., 2013
Phenotype of all Fish created by or utilizing MO1-twsg1b
Phenotype Fish Conditions Figures
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1 from Esser et al., 2018
intersegmental vein malformed, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus dilated, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1,  Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 2 from Esser et al., 2018
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 2 from Esser et al., 2018
posterior caudal vein malformed, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 2 from Esser et al., 2018
sprouting angiogenesis process quality, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO1-twsg1b standard conditions Fig. 1 from Esser et al., 2018
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
intersegmental vein malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased amount, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus dilated, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1,  Fig. 2 from Esser et al., 2018
posterior caudal vein malformed, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
caudal vein plexus efnb2a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus efnb2a expression mislocalised, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 1 from Esser et al., 2018
sprouting angiogenesis process quality, abnormal y1Tg + MO1-twsg1b + MO3-bmper standard conditions Fig. 8 with image from Heinke et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.