| ZFIN ID: ZDB-SSLP-980528-676 |
| SSLP: | z6329 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 16 | 24.2 cM | z6329 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 16 | 75.35 cR | Z6329 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 16 | 415.0 cR | z6329 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 16 | 17.6 cM | z6329 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z6365 | SSLP | 16 | Baxendale et al., 2004 | Baxendale et al. Nat. Gen. 36(1):88-93 (2004) mapped the ubo locus to a 1.1 cM ... | |
| z19602 | SSLP | 16 | Baxendale et al., 2004 | Baxendale et al. Nat. Gen. 36(1):88-93 (2004) mapped the ubo locus to a 1.1 cM ... | |
| tp39 | Feature | 16 | 0.42 cM | Baxendale et al., 2004 | Baxendale et al. Nat. Gen. 36(1):88-93 (2004) mapped the ubo locus to a 1.1 cM ... |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | 240 | 60.0 | |
| Forward Primer | AAACACAATGCCTCTCCCAG | ||
| Reverse Primer | TCCAAAAACCACACGTAGCA | ||
| AB | 260 | 60.0 | |
| Forward Primer | AAACACAATGCCTCTCCCAG | ||
| Reverse Primer | TCCAAAAACCACACGTAGCA | ||
| EKW | 260 | 60.0 | |
| Forward Primer | AAACACAATGCCTCTCCCAG | ||
| Reverse Primer | TCCAAAAACCACACGTAGCA | ||
| TU | 260,0,262 | 60.0 | |
| Forward Primer | AAACACAATGCCTCTCCCAG | ||
| Reverse Primer | TCCAAAAACCACACGTAGCA |