| ZFIN ID: ZDB-SSLP-980528-550 |
| SSLP: | z4910 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 12 | 5095.0 cR | z4910 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z4950 | SSLP | 6 | Karlstrom et al., 2003 | Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6. | |
| z3581 | SSLP | 6 | Karlstrom et al., 2003 | Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6. | |
| ts269 | Feature | 6 | Karlstrom et al., 2003 | Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6. | |
| gli1 | GENE | 6 | Karlstrom et al., 2003 | Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | 414 | ||
| Forward Primer | TTGAGGGCATCCGCTGTGTA | ||
| Reverse Primer | TGAGTGCTTCAGCACCCTGG | ||
| AB | 398 | ||
| Forward Primer | TTGAGGGCATCCGCTGTGTA | ||
| Reverse Primer | TGAGTGCTTCAGCACCCTGG |