| ZFIN ID: ZDB-SSLP-980528-340 |
| SSLP: | z3124 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 9 | 40.5 cM | z3124 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 9 | 251.9 cR | Z3124 | Loeb/NIH/5000/4000 (LN54) | Johnson, Stephen L. | Data |
| 9 | 795.0 cR | z3124 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 9 | 30.6 cM | z3124 | Heat Shock (HS) | Woods, Ian G. | Data |
| 9 | 38.03 cM | Gates et al (GAT) | Talbot, William S. | Data | |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z6430 | SSLP | 9 | Bahadori et al., 2003 | Bahadori et al. (2002., European journal of Neuroscience 18:1377-1386) report the mapping of ovl to LG 9. At the time of mapping ovl was mapped 50.2 cM from the top of LG 9 between the markers z3124 and z6430. | |
| tz288 | Feature | 9 | Bahadori et al., 2003 | Bahadori et al. (2002., European journal of Neuroscience 18:1377-1386) report the mapping of ovl to LG 9. At the time of mapping ovl was mapped 50.2 cM from the top of LG 9 between the markers z3124 and z6430. | |
| z34459 | SSLP | 9 | Larson et al., 2010 | ||
| tuba8l3 | GENE | 9 | Larson et al., 2010 | ||
| j115e1 | Feature | 9 | Larson et al., 2010 | ||
| dnajb2 | GENE | 9 | Larson et al., 2010 |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | 133,131 | 60.0 | |
| Forward Primer | CGGCTCCACAGGAACATGAC | ||
| Reverse Primer | GCCGATGCCATTTTCTGTCC | ||
| AB | 135 | 60.0 | |
| Forward Primer | CGGCTCCACAGGAACATGAC | ||
| Reverse Primer | GCCGATGCCATTTTCTGTCC | ||
| TL | 135,133 | 60.0 | |
| Forward Primer | CGGCTCCACAGGAACATGAC | ||
| Reverse Primer | GCCGATGCCATTTTCTGTCC | ||
| TU | 141,213 | 60.0 | |
| Forward Primer | CGGCTCCACAGGAACATGAC | ||
| Reverse Primer | GCCGATGCCATTTTCTGTCC |