Community Action Needed: Please respond to the NIH RFI
ZFIN ID: ZDB-SSLP-980528-279

Mapping Details

SSLP: z1660
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
9 52.3 cM z1660 Boston MGH Cross (MGH) Fishman, Mark C. Data
9 2722.0 cR z1660 Goodfellow T51 (T51) Geisler, Robert Data
9 55.56 cM Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z5080 SSLP 9 Karlstrom et al., 1999
z5564 SSLP 9 Karlstrom et al., 1999
ty17a Feature 9 Karlstrom et al., 1999
twist2 GENE 9 Karlstrom et al., 1999
j1607aTg Feature 9 ZIRC and ZFIN staff

OTHER MAPPING INFORMATION
Chr 9 Karlstrom et al., 1999
Chr 9 ZIRC and ZFIN staff
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
IND NA
Forward Primer TGCCGAGCGCAGAAATAAAA
Reverse Primer GAGGATATTTGGGTGCACCAAA
AB NA
Forward Primer TGCCGAGCGCAGAAATAAAA
Reverse Primer GAGGATATTTGGGTGCACCAAA