| ZFIN ID: ZDB-SSLP-980528-2027 |
| SSLP: | z22745 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 6 | 54.9 cM | z22745 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 6 | 3967.0 cR | z22745 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 6 | 102.7 cM | z22745 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z7248 | SSLP | 6 | Doll et al., 2011 | Doll, et al. (2011. Dev Biol. 360:44-57.) reports mapping mutant c163 to the ... | |
| c163 | Feature | 6 | Doll et al., 2011 | Doll, et al. (2011. Dev Biol. 360:44-57.) reports mapping mutant c163 to the ... | |
| sec61a1a | GENE | 6 | Doll et al., 2011 | Doll, et al. (2011. Dev Biol. 360:44-57.) reports mapping mutant c163 to the ... |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 218,210 | 60.0 | |
| Forward Primer | TGCTCAAACCAGCAACAGAC | ||
| Reverse Primer | CCCTCTGTTGACTAGTCCCC | ||
| IND | 216,206 | 60.0 | |
| Forward Primer | TGCTCAAACCAGCAACAGAC | ||
| Reverse Primer | CCCTCTGTTGACTAGTCCCC | ||
| TU | 216,206 | 60.0 | |
| Forward Primer | TGCTCAAACCAGCAACAGAC | ||
| Reverse Primer | CCCTCTGTTGACTAGTCCCC | ||
| EKW | 210 | 60.0 | |
| Forward Primer | TGCTCAAACCAGCAACAGAC | ||
| Reverse Primer | CCCTCTGTTGACTAGTCCCC |