| ZFIN ID: ZDB-SSLP-980528-2000 |
| SSLP: | z22422 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 10 | 52.2 cM | z22422 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 10 | 39.7 cM | z22422 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z3835 | SSLP | 10 | Zhang et al., 2001 | Zhang, et al. (2001. Dev Biol 240:560-573.) crossed unpte314b on the TU background with polymorphic WIK fish. F1 heterozygotes were crossed and wild type and homozygous mutants were analyzed using bulk segregant analysis. The unplugged locus was mapped to LG10 between z3835 and Z22422. | |
| te314b | Feature | 10 | 0.2 cM | Zhang et al., 2001 | Zhang, et al. (2001. Dev Biol 240:560-573.) crossed unpte314b on the TU background with polymorphic WIK fish. F1 heterozygotes were crossed and wild type and homozygous mutants were analyzed using bulk segregant analysis. The unplugged locus was mapped to LG10 between z3835 and Z22422. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 0,212 | 60.0 | |
| Forward Primer | CCCTTGAGCAAGGCATTTAA | ||
| Reverse Primer | TCGGTATTGGCAAGTAAGGG | ||
| IND | 0,184 | 60.0 | |
| Forward Primer | CCCTTGAGCAAGGCATTTAA | ||
| Reverse Primer | TCGGTATTGGCAAGTAAGGG | ||
| TU | 230 | 60.0 | |
| Forward Primer | CCCTTGAGCAAGGCATTTAA | ||
| Reverse Primer | TCGGTATTGGCAAGTAAGGG | ||
| EKW | 0,212 | 60.0 | |
| Forward Primer | CCCTTGAGCAAGGCATTTAA | ||
| Reverse Primer | TCGGTATTGGCAAGTAAGGG |