ZFIN ID: ZDB-SSLP-980528-167

Mapping Details

SSLP: z1148
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
22 0.0 cM z1148 Boston MGH Cross (MGH) Fishman, Mark C. Data
22 0.0 cM z1148 Mother of Pearl (MOP) Postlethwait, John H. Data
22 14.97 cR Z1148 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
22 416.0 cR z1148 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
arntl1a GENE 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465  ...
z669 SSLP 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465  ...
z11262 SSLP 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465  ...

OTHER MAPPING INFORMATION
Chr 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465 near SSLP markers  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 200 60.0
Forward Primer TCAGTGTGCTCGCACTAACC
Reverse Primer GTCTGAGCAGCTGCAGTACG
IND 196,238 60.0
Forward Primer TCAGTGTGCTCGCACTAACC
Reverse Primer GTCTGAGCAGCTGCAGTACG
TL 0,174,238 60.0
Forward Primer TCAGTGTGCTCGCACTAACC
Reverse Primer GTCTGAGCAGCTGCAGTACG
TU 174 60.0
Forward Primer TCAGTGTGCTCGCACTAACC
Reverse Primer GTCTGAGCAGCTGCAGTACG