ZFIN ID: ZDB-SSLP-980528-1497

Mapping Details

SSLP: z11262
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
22 0.0 cM z11262 Boston MGH Cross (MGH) Fishman, Mark C. Data
22 421.0 cR z11262 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
wz12434 EST 22 Wada et al., 2006
zeh1122 EST 22 Wada et al., 2006
celsr2_unspecified Feature 22 0.24 cM Wada et al., 2006
z1148 SSLP 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465  ...
arntl1a GENE 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465  ...
z669 SSLP 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465  ...

OTHER MAPPING INFORMATION
Chr 22 ZFIN Curated Data While investigating arntl1a (bmal1) gene, bmal1 was found on Sanger ctg15465 near SSLP markers  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 0,259 60.0
Forward Primer ATTCACAGGGCACAGTTTCC
Reverse Primer GATCCAGGAGTGCGAAGATC
IND 0,245 60.0
Forward Primer ATTCACAGGGCACAGTTTCC
Reverse Primer GATCCAGGAGTGCGAAGATC
EKW 259,217 60.0
Forward Primer ATTCACAGGGCACAGTTTCC
Reverse Primer GATCCAGGAGTGCGAAGATC
TU 0,219 60.0
Forward Primer ATTCACAGGGCACAGTTTCC
Reverse Primer GATCCAGGAGTGCGAAGATC