| ZFIN ID: ZDB-SSLP-980528-1396 |
| SSLP: | z10456 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 38.6 cM | z10456 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 5 | 95.29 cR | Z10456 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 5 | 1986.0 cR | z10456 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z7351 | SSLP | 5 | Piotrowski et al., 2003 | Piotrowski et al. (2003) used radiation hybrid and meiotic mapping panels to show that tbx1 and vgom208 lie on LG 5 between markers z7351/fb38h03 and z10456. | |
| tm208 | Feature | 5 | Piotrowski et al., 2003 | Piotrowski et al. (2003) used radiation hybrid and meiotic mapping panels to show that tbx1 and vgom208 lie on LG 5 between markers z7351/fb38h03 and z10456. | |
| fb38h03 | EST | 5 | 8.4 cR | Piotrowski et al., 2003 | Piotrowski et al. (2003) used radiation hybrid and meiotic mapping panels to show that tbx1 and vgom208 lie on LG 5 between markers z7351/fb38h03 and z10456. |
| tbx1 | GENE | 5 | 5.8 cR | Piotrowski et al., 2003 | Piotrowski et al. (2003) used radiation hybrid and meiotic mapping panels to show that tbx1 and vgom208 lie on LG 5 between markers z7351/fb38h03 and z10456. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 203 | 60.0 | |
| Forward Primer | GTGGATGACCACTGAGCAAG | ||
| Reverse Primer | ACCCTCAGCTGCTCTCTGAG | ||
| IND | 191,135 | 60.0 | |
| Forward Primer | GTGGATGACCACTGAGCAAG | ||
| Reverse Primer | ACCCTCAGCTGCTCTCTGAG | ||
| TU | 203 | 60.0 | |
| Forward Primer | GTGGATGACCACTGAGCAAG | ||
| Reverse Primer | ACCCTCAGCTGCTCTCTGAG | ||
| EKW | 203,143 | 60.0 | |
| Forward Primer | GTGGATGACCACTGAGCAAG | ||
| Reverse Primer | ACCCTCAGCTGCTCTCTGAG |