Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
20	38.9 cM	z10056	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
20	29.7 cM	z10056	Mother of Pearl (MOP)	Postlethwait, John H.	Data
20	341.65 cR	Z10056	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
20	275.0 cR	z10056	Goodfellow T51 (T51)	Geisler, Robert	Data
20	22.9 cM	z10056	Heat Shock (HS)	Woods, Ian G.	Data
20	6.25 cM		Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z9343	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z3954	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z7171	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z9794	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
cdh2	GENE	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z23564	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z21170	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z22659	SSLP	20		Pogoda et al., 2009	Pogoda and Hammerschmidt (2009) report complementation crosses revealed that  ... Pogoda and Hammerschmidt (2009) report complementation crosses revealed that fr15 and fr16 are allelic, whereas they did complement dog/aal, ruling out that they are mutations in eya1. Initial bulked segregation mapping placed the fr15/fr16 locus on chromosome 20 in an interval between the SSLP markers z10056 (8 recombinations in 50 meioses) and z35375 (2/80), close to the marker z22659 (0/42) and an SSLP marker found in psmc6 (0/72).
z35375	SSLP	20		Pogoda et al., 2009	Pogoda and Hammerschmidt (2009) report complementation crosses revealed that  ... Pogoda and Hammerschmidt (2009) report complementation crosses revealed that fr15 and fr16 are allelic, whereas they did complement dog/aal, ruling out that they are mutations in eya1. Initial bulked segregation mapping placed the fr15/fr16 locus on chromosome 20 in an interval between the SSLP markers z10056 (8 recombinations in 50 meioses) and z35375 (2/80), close to the marker z22659 (0/42) and an SSLP marker found in psmc6 (0/72).
fr15	Feature	20		Pogoda et al., 2009	Pogoda and Hammerschmidt (2009) report complementation crosses revealed that  ... Pogoda and Hammerschmidt (2009) report complementation crosses revealed that fr15 and fr16 are allelic, whereas they did complement dog/aal, ruling out that they are mutations in eya1. Initial bulked segregation mapping placed the fr15/fr16 locus on chromosome 20 in an interval between the SSLP markers z10056 (8 recombinations in 50 meioses) and z35375 (2/80), close to the marker z22659 (0/42) and an SSLP marker found in psmc6 (0/72).
fr16	Feature	20		Pogoda et al., 2009	Pogoda and Hammerschmidt (2009) report complementation crosses revealed that  ... Pogoda and Hammerschmidt (2009) report complementation crosses revealed that fr15 and fr16 are allelic, whereas they did complement dog/aal, ruling out that they are mutations in eya1. Initial bulked segregation mapping placed the fr15/fr16 locus on chromosome 20 in an interval between the SSLP markers z10056 (8 recombinations in 50 meioses) and z35375 (2/80), close to the marker z22659 (0/42) and an SSLP marker found in psmc6 (0/72).

OTHER MAPPING INFORMATION

Chr 20 Masai et al., 2003 Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of  ... Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).   Chr 20 Pogoda et al., 2009 Pogoda and Hammerschmidt (2009) report complementation crosses revealed that fr15 and fr16 are  ... Pogoda and Hammerschmidt (2009) report complementation crosses revealed that fr15 and fr16 are allelic, whereas they did complement dog/aal, ruling out that they are mutations in eya1. Initial bulked segregation mapping placed the fr15/fr16 locus on chromosome 20 in an interval between the SSLP markers z10056 (8 recombinations in 50 meioses) and z35375 (2/80), close to the marker z22659 (0/42) and an SSLP marker found in psmc6 (0/72).

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	0,198		60.0
Forward Primer	TTGCAATGTGTATGCTGTCAAA
Reverse Primer	CAAGTGTCCACTCACCCAAA
IND	180		60.0
Forward Primer	TTGCAATGTGTATGCTGTCAAA
Reverse Primer	CAAGTGTCCACTCACCCAAA
TU	184,182		60.0
Forward Primer	TTGCAATGTGTATGCTGTCAAA
Reverse Primer	CAAGTGTCCACTCACCCAAA
EKW	200		60.0
Forward Primer	TTGCAATGTGTATGCTGTCAAA
Reverse Primer	CAAGTGTCCACTCACCCAAA