| ZFIN ID: ZDB-SSLP-980528-1267 |
| SSLP: | z9708 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 20 | 21.2 cM | z9708 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 20 | 18.1 cM | z9708 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 20 | 69.68 cR | Z9708 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 20 | 1.0 cR | z9708 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 20 | 15.5 cM | z9708 | Heat Shock (HS) | Woods, Ian G. | Data |
| 20 | 2.08 cM | Gates et al (GAT) | Talbot, William S. | Data | |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z7603 | SSLP | 20 | Hall et al., 2007 | Hall, et al. (2007. P.N.A.S. 104:7092-7097) reports mapping the teg15a and ... | |
| z7603 | SSLP | 20 | Hall et al., 2007 | all, et al. (2007. P.N.A.S. 104:7092-7097) reports mapping the teg15a and ... | |
| teg15a | Feature | 20 | Hall et al., 2007 | Hall, et al. (2007. P.N.A.S. 104:7092-7097) reports mapping the teg15a and ... | |
| tk209 | Feature | 20 | Hall et al., 2007 | all, et al. (2007. P.N.A.S. 104:7092-7097) reports mapping the teg15a and ... |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 208,186 | 60.0 | |
| Forward Primer | GAGCGGCAAGTATGTGGATT | ||
| Reverse Primer | AGGAGGCGAATCAGACTGAA | ||
| IND | 228,154 | 60.0 | |
| Forward Primer | GAGCGGCAAGTATGTGGATT | ||
| Reverse Primer | AGGAGGCGAATCAGACTGAA | ||
| TU | 162,0,198 | 60.0 | |
| Forward Primer | GAGCGGCAAGTATGTGGATT | ||
| Reverse Primer | AGGAGGCGAATCAGACTGAA | ||
| EKW | 340,186 | 60.0 | |
| Forward Primer | GAGCGGCAAGTATGTGGATT | ||
| Reverse Primer | AGGAGGCGAATCAGACTGAA |