header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SSLP-980528-1039

Mapping Details

SSLP: z8450
PHYSICAL MAP AND BROWSERNo data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 51.5cM z8450 Boston MGH Cross (MGH) Fishman, Mark C. Data
12 3948.0cR z8450 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
slc16a6a GENE 12 Hugo et al., 2012
z24996 SSLP 12 Hugo et al., 2012
z26278 SSLP 12 Hugo et al., 2012
z22103 SSLP 12 Hugo et al., 2012
s951 Feature 12 Hugo et al., 2012
to6 Feature 12 Sonawane et al., 2005 penner was located 49.1 cM from the top of chromosome 12, between z3801  ...
z3801 SSLP 12 Sonawane et al., 2005 penner was located 49.1 cM from the top of chromosome 12, between z3801  ...

OTHER MAPPING INFORMATION
Chr 12 Sonawane et al., 2005 penner was located 49.1 cM from the top of chromosome 12, between z3801 (21/1872 meioses)  ...
Chr 12 Hugo et al., 2012
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 197,0,327 60.0
Forward Primer GGCTGAATGATATCGCGAAT
Reverse Primer ATTTTGTCAGCCAAACCCAG
IND 0,289,255 60.0
Forward Primer GGCTGAATGATATCGCGAAT
Reverse Primer ATTTTGTCAGCCAAACCCAG
TU 0,327 60.0
Forward Primer GGCTGAATGATATCGCGAAT
Reverse Primer ATTTTGTCAGCCAAACCCAG
EKW 0,197 60.0
Forward Primer GGCTGAATGATATCGCGAAT
Reverse Primer ATTTTGTCAGCCAAACCCAG