ZFIN ID: ZDB-GENE-990616-47

Mapping Details

Gene Name: forkhead box B1a
Symbol: foxb1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 25 34,154,171 - 34,156,152 GRCz11
Ensembl 25 34,154,171 - 34,156,152 GRCz11
Vega 25 33,668,744 - 33,670,725 GRCv10
NCBI Map Viewer 25 34,154,171 - 34,156,082 GRCz11
UCSC 25 - GRCv10
Mapped Clones containing foxb1a
CH211-2C17 Chr: 25 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
25 126.6 cM mariposa Mother of Pearl (MOP) Postlethwait, John H. Data
25 521.78 cR foxb1_2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
25 3679.0 cR foxb1.2 Goodfellow T51 (T51) Geisler, Robert Data
25 85.1 cM foxb1_2 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z15401 SSLP 25 Farber et al., 2003 Farber et al (Genome Res 13, 1082-1096, 2003) mapped the anxa2a gene to LG25  ...
anxa2a GENE 25 10.0 cR Farber et al., 2003 Farber et al (Genome Res 13, 1082-1096, 2003) mapped the anxa2a gene to LG25  ...

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 104,100 36.0
Forward Primer CTTGTCTCAGTCTGCAAACCA
Reverse Primer CTTCAAGTTTGCAATTGTAGCA