Community Action Needed: Please respond to the NIH RFI
ZFIN ID: ZDB-GENE-980526-192

Mapping Details

Gene Name: collagen, type II, alpha 1a
Symbol: col2a1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 8 21,195,420 - 21,219,473 GRCz11
Ensembl 8 21,195,420 - 21,219,473 GRCz11
Vega 8 21,163,335 - 21,187,388 GRCv10
NCBI Map Viewer 8 21,195,387 - 21,219,474 GRCz11
UCSC 8 - GRCv10
Mapped Clones containing col2a1a
CH211-216K22 Chr: 8 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa532 8 21,208,849 GRCz11 Busch-Nentwich et al., 2013
8 21,176,764 GRCz10 Busch-Nentwich et al., 2013
8 21,746,867 Zv9 Busch-Nentwich et al., 2013
sa21270 8 21,202,865 GRCz11 Busch-Nentwich et al., 2013
8 21,170,780 GRCz10 Busch-Nentwich et al., 2013
8 21,740,883 Zv9 Busch-Nentwich et al., 2013
sa34379 8 21,198,249 GRCz11 Busch-Nentwich et al., 2013
8 21,166,164 GRCz10 Busch-Nentwich et al., 2013
8 21,736,267 Zv9 Busch-Nentwich et al., 2013
sa34380 8 21,202,837 GRCz11 Busch-Nentwich et al., 2013
8 21,170,752 GRCz10 Busch-Nentwich et al., 2013
8 21,740,855 Zv9 Busch-Nentwich et al., 2013
uq36bh 8 21,202,638 - 21,202,640 GRCz11 Chaudhury et al., 2020

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
8 73.7 cM col2a1 Mother of Pearl (MOP) Postlethwait, John H. Data
8 260.91 cR col2a1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
8 56.6 cM col2a1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by col2a1a
fb38c06 Chr: 8 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 605 DpnII 36.0
Forward Primer CCTAAAATCCCACGCAAGAA
Reverse Primer CTTGCAGCCATCCTCAAGTA