ZFIN ID: ZDB-GENE-980526-192

ZFIN ID: ZDB-GENE-980526-192

Mapping Details

Gene Name:	collagen, type II, alpha 1a
Symbol:	col2a1a

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	8	23,069,742 - 23,093,816	GRCz12tu
NCBI Map Viewer	8	23,069,742 - 23,093,816	GRCz12tu
Ensembl	8	21,195,420 - 21,219,473	GRCz11
NCBI Map Viewer	8	21,195,395 - 21,219,474	GRCz11
UCSC	8	-	GRCz11
Vega	8	21,163,335 - 21,187,388	GRCv10

Mapped Clones containing col2a1a
CH211-216K22	Chr: 8 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa532	8	23,083,191	GRCz12tu	DIRECT		Sealy et al., 2025
	8	21,208,849	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	8	21,176,764	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	8	21,746,867	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa21270	8	23,077,207	GRCz12tu	DIRECT		Sealy et al., 2025
	8	21,202,865	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	8	21,170,780	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	8	21,740,883	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa34379	8	23,072,596	GRCz12tu	DIRECT		Sealy et al., 2025
	8	21,198,249	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	8	21,166,164	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	8	21,736,267	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa34380	8	23,077,179	GRCz12tu	DIRECT		Sealy et al., 2025
	8	21,202,837	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	8	21,170,752	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	8	21,740,855	Zv9	DIRECT		Busch-Nentwich et al., 2013
uq36bh	8	21,202,638 - 21,202,640	GRCz11	DIRECT		Chaudhury et al., 2020
dmh27	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
dmh28	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
sa532	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa21270	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa34379	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa34380	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
uq36bh	8		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	8		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
8	73.7 cM	col2a1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
8	260.91 cR	col2a1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
8	56.6 cM	col2a1	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by col2a1a
fb38c06 Chr: 8 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	605	DpnII	36.0
Forward Primer	CCTAAAATCCCACGCAAGAA
Reverse Primer	CTTGCAGCCATCCTCAAGTA