ZFIN ID: ZDB-GENE-980526-127

ZFIN ID: ZDB-GENE-980526-127

Mapping Details

Gene Name:	eukaryotic translation initiation factor 4E family member 1B
Symbol:	eif4e1b

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	5	73,710,358 - 73,819,921	GRCz12tu
NCBI Map Viewer	5	73,710,358 - 73,819,921	GRCz12tu
NCBI Map Viewer	5	67,787,965 - 67,799,648	GRCz11

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa20588	5	73,819,336	GRCz12tu	DIRECT		Sealy et al., 2025
	5	67,799,065	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	5	67,121,354	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	5	71,170,881	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa40603	5	73,811,812	GRCz12tu	DIRECT		Sealy et al., 2025
	5	67,791,404	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	5	67,113,684	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	5	71,179,846	Zv9	DIRECT		Busch-Nentwich et al., 2013
vbc24	5	67,799,070 - 67,799,080	GRCz11	DIRECT		Lorenzo-Orts et al., 2023
vbc25	5	67,799,071 - 67,799,089	GRCz11	DIRECT		Lorenzo-Orts et al., 2023
sa20588	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa40603	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
vbc24	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
vbc25	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
5	246.6 cM	eif4e	Mother of Pearl (MOP)	Postlethwait, John H.	Data
5	332.59 cR	eif4e	Loeb/NIH/5000/4000 (LN54)	Johnson, Stephen L.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	446	MspI	36.0
Forward Primer	GTGCATTACTGTACTGTTGACTA
Reverse Primer	CATGCGGTACAGGTGAATTGGG