ZFIN ID: ZDB-GENE-980526-102

Mapping Details

Gene Name: SRY-box transcription factor 19a
Symbol: sox19a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 5 24,199,180 - 24,201,437 GRCz11
Ensembl 5 24,199,180 - 24,201,437 GRCz11
Vega 5 23,695,380 - 23,697,637 GRCv10
NCBI Map Viewer 5 24,199,180 - 24,201,444 GRCz11
UCSC 5 - GRCv10
Mapped Clones containing sox19a
CH211-137I24 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa6054 5 24,200,827 GRCz11 Busch-Nentwich et al., 2013
5 23,697,027 GRCz10 Busch-Nentwich et al., 2013
5 25,869,762 Zv9 Busch-Nentwich et al., 2013
sa7562 5 24,201,159 GRCz11 Busch-Nentwich et al., 2013
5 23,697,359 GRCz10 Busch-Nentwich et al., 2013
5 25,870,094 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 73.9 cM sox19 Mother of Pearl (MOP) Postlethwait, John H. Data
5 1994.0 cR sox19 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by sox19a
fc66c01 Chr: 5 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 815 MseI 36.0
Forward Primer CGCCTCTTACACACATCTGA
Reverse Primer TGACTCCCCTTTTTACACAACT