ZFIN ID: ZDB-GENE-051010-1

ZFIN ID: ZDB-GENE-051010-1

Mapping Details

Gene Name:	Indian hedgehog signaling molecule a
Symbol:	ihha

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	9	7,434,004 - 7,442,604	GRCz12tu
NCBI Map Viewer	9	7,434,004 - 7,442,604	GRCz12tu
Ensembl	9	7,358,749 - 7,367,278	GRCz11
NCBI Map Viewer	9	7,358,749 - 7,367,278	GRCz11
UCSC	9	-	GRCz11
Vega	9	7,380,358 - 7,388,887	GRCv10
Vega	9	7,379,428 - 7,381,093	GRCv10

Mapped Clones containing ihha
CH211-67P4	Chr: 9 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
hu2131	9	7,434,452	GRCz12tu	DIRECT		Sealy et al., 2025
	9	7,359,197	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	9	7,380,806	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	9	7,400,713	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa30645	9	7,442,404	GRCz12tu	DIRECT		Sealy et al., 2025
	9	7,367,078	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	9	7,388,687	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	9	7,408,594	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa34554	9	7,442,497	GRCz12tu	DIRECT		Sealy et al., 2025
	9	7,367,171	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	9	7,388,780	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	9	7,408,687	Zv9	DIRECT		Busch-Nentwich et al., 2013
hu2131	9		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa30645	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	9		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
sa34554	9		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	9		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
9	51.1 cM	hha	Mother of Pearl (MOP)	Postlethwait, John H.	Data
9	492.0 cR	ihha	Goodfellow T51 (T51)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	545	MseI	36.0
Forward Primer	CTTAACTGCAAATACGTGTGAATG
Reverse Primer	TCTTGTTGAACCTGCTGTCG