ZFIN ID: ZDB-GENE-980526-485

ZFIN ID: ZDB-GENE-980526-485

Mapping Details

Gene Name:	POU domain, class 5, transcription factor 3
Symbol:	pou5f3

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	21	15,085,975 - 15,090,834	GRCz12tu
NCBI Map Viewer	21	15,085,975 - 15,090,834	GRCz12tu
Ensembl	21	13,685,853 - 13,690,712	GRCz11
NCBI Map Viewer	21	13,685,853 - 13,690,719	GRCz11
UCSC	21	-	GRCz11
Vega	21	13,589,124 - 13,593,983	GRCv10

Mapped Clones containing pou5f3
CH73-205E12	Chr: 21 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	Citations
e713	21	13,687,101	GRCz11	DIRECT	Burgess et al., 2002
hi349Tg	21	13,689,438 - 13,689,439	GRCz11	DIRECT	ZFIN Curated Data
hi1757Tg	21	13,692,718 - 13,692,719	GRCz11	DIRECT	ZFIN Curated Data
hi1940Tg	21	13,690,021 - 13,690,022	GRCz11	DIRECT	ZFIN Curated Data
ihb137	21	13,689,976 - 13,689,979	GRCz11	DIRECT	Zhang et al., 2020
ihb893	21	13,689,972 - 13,689,976	GRCz11	DIRECT	Wang et al., 2023
ihb934	21	13,689,975 - 13,689,981	GRCz11	DIRECT	Zebrafish Nomenclature Committee
ihb935	21	13,689,956 - 13,689,980	GRCz11	DIRECT	Zebrafish Nomenclature Committee
m216	21	13,687,101	GRCz11	DIRECT	Belting et al., 2001
sa1294	21	15,087,197	GRCz12tu	DIRECT	Sealy et al., 2025
	21	13,687,075	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	21	13,590,346	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	21	11,889,172	Zv9	DIRECT	Busch-Nentwich et al., 2013
sa1329	21	15,090,554	GRCz12tu	DIRECT	Sealy et al., 2025
	21	13,690,432	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	21	13,593,703	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	21	11,892,529	Zv9	DIRECT	Busch-Nentwich et al., 2013
sud25	21	13,690,395 - 13,690,401	GRCz11	DIRECT	Yuikawa et al., 2023
la013973Tg	21	11,890,655 - 11,890,665	Zv9	ZFIN_Zv9
e68	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
e713	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
hi349Tg	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
hi1757Tg	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
hi1940Tg	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ihb137	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ihb138	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ihb893	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
la013973Tg	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
m216	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
m308	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
m793	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
pou5f3_unspecified	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
sud25	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
wi270Tg	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data
zf3267	21		GRCz11	OTHER_MAPPING	ZFIN Curated Data

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
21	57.8 cM	pou2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
21	1331.0 cR	pou2	Goodfellow T51 (T51)	Geisler, Robert	Data
21	50.3 cM	pou2	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by pou5f3
chunp6868 Chr: 21 Details
fd18d06 Chr: 21 Details

Genomic Feature m793 is an allele of pou5f3

Marker	Type	Chr	Distance	Publication / Person	Comments
z21718	SSLP	21		Belting et al., 2001	Using a panel of 2418 spg^m793/spg^m793 embryos, Belting, et al. (2001. Dev 128:4165-4176.) report mapping the spg^m793 mutant to LG21 between z12068 and z21718.
z12068	SSLP	21		Belting et al., 2001	Using a panel of 2418 spg^m793/spg^m793 embryos, Belting, et al. (2001. Dev 128:4165-4176.) report mapping the spg^m793 mutant to LG21 between z12068 and z21718.

Genomic Feature e713 is an allele of pou5f3

Marker	Type	Chr	Distance	Publication / Person	Comments
z13467	SSLP	21		Burgess et al., 2002	Burgess et al. (2002 Development 129:905-916) reported no recombinants between the SSLP z13467 and the spg^e713 mutant phenotype among 39 haploid embryos obtained from a heterozygous carrier female.

Genomic Feature e713 is an allele of pou5f3

Chr 21

Burgess et al., 2002

Burgess et al. (2002 Development 129:905-916) reported no recombinants between the SSLP z13467 and ...

Genomic Feature m793 is an allele of pou5f3

Chr 21

Belting et al., 2001

Using a panel of 2418 spg^m793/spg^m793 embryos, Belting, et al. ...

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	796	BfaI	36.0
Forward Primer	GCCCTTTGATGACGAGTGTG
Reverse Primer	TTGGAGATGGGAGAGTGCAA

Genomic Feature ihb893 is an allele of pou5f3