ZFIN ID: ZDB-GENE-980526-221

Mapping Details

Gene Name: desmin a
Symbol: desma
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 9 7,593,139 - 7,616,601 GRCz12tu
NCBI Map Viewer 9 7,593,139 - 7,616,601 GRCz12tu
Ensembl 9 7,515,864 - 7,539,326 GRCz11
NCBI Map Viewer 9 7,515,864 - 7,539,326 GRCz11
UCSC 9 - GRCz11
UCSC 9 - GRCz11
Vega 9 7,537,473 - 7,560,935 GRCv10
Mapped Clones containing desma
CH73-129N15 Chr: 9 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
kg97 9 7,539,128 - 7,539,129 GRCz11 DIRECT Kayman Kürekçi et al., 2021
sa5 9 7,603,533 GRCz12tu DIRECT Sealy et al., 2025
9 7,526,258 GRCz11 DIRECT Busch-Nentwich et al., 2013
9 7,547,867 GRCz10 DIRECT Busch-Nentwich et al., 2013
9 7,567,774 Zv9 DIRECT Busch-Nentwich et al., 2013
sa15298 9 7,597,151 GRCz12tu DIRECT Sealy et al., 2025
9 7,519,876 GRCz11 DIRECT Busch-Nentwich et al., 2013
9 7,541,485 GRCz10 DIRECT Busch-Nentwich et al., 2013
9 7,561,392 Zv9 DIRECT Busch-Nentwich et al., 2013
sa34555 9 7,609,725 GRCz12tu DIRECT Sealy et al., 2025
9 7,532,450 GRCz11 DIRECT Busch-Nentwich et al., 2013
9 7,554,059 GRCz10 DIRECT Busch-Nentwich et al., 2013
9 7,573,966 Zv9 DIRECT Busch-Nentwich et al., 2013
umu10 9 7,539,233 - 7,539,241 GRCz11 DIRECT Dennhag et al., 2024
ct122aGt 9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ct122aRGt 9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
kg97 9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa5 9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa15298 9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa34555 9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
umu10 9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
9 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
9 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
9 47.1 cM des Mother of Pearl (MOP) Postlethwait, John H. Data
9 261.34 cR desm Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
9 496.0 cR desm Goodfellow T51 (T51) Geisler, Robert Data
9 25.8 cM desmin Heat Shock (HS) Woods, Ian G. Data
9 25.53 cM desm Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by desma
fb59a12 Chr: 9 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 180 36.0
Forward Primer GCAGTGACCCATTACCGCAT
Reverse Primer CAGATATGACCCAACCACAC
Genomic Feature kg97 is an allele of desma