ZFIN ID: ZDB-GENE-980526-488

Mapping Details

Gene Name: fibroblast growth factor receptor 4
Symbol: fgfr4
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 21 40,845,171 - 40,856,029 GRCz12tu
NCBI Map Viewer 21 40,845,171 - 40,856,029 GRCz12tu
Ensembl 21 37,183,902 - 37,194,365 GRCz11
NCBI Map Viewer 21 37,183,893 - 37,194,703 GRCz11
UCSC 21 - GRCz11
Vega 21 37,498,712 - 37,509,505 GRCv10
Mapped Clones containing fgfr4
CH211-281E1 Chr: 21 Details
DKEY-53B2 Chr: 21 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
hu3514 21 40,852,683 GRCz12tu DIRECT Sealy et al., 2025
21 37,191,370 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 37,506,183 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 36,516,834 Zv9 DIRECT Busch-Nentwich et al., 2013
sa6682 21 40,850,324 GRCz12tu DIRECT Sealy et al., 2025
21 37,189,029 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 37,503,842 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 36,514,493 Zv9 DIRECT Busch-Nentwich et al., 2013
sa24004 21 40,849,430 GRCz12tu DIRECT Sealy et al., 2025
21 37,188,135 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 37,502,948 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 36,513,599 Zv9 DIRECT Busch-Nentwich et al., 2013
sa24005 21 40,851,971 GRCz12tu DIRECT Sealy et al., 2025
21 37,190,676 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 37,505,489 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 36,516,140 Zv9 DIRECT Busch-Nentwich et al., 2013
sa37357 21 40,847,486 GRCz12tu DIRECT Sealy et al., 2025
21 37,186,203 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 37,501,016 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 36,511,667 Zv9 DIRECT Busch-Nentwich et al., 2013
la022005Tg 21 36,510,573 - 36,510,583 Zv9 ZFIN_Zv9 BurgessLin
hu3514 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hu3582 21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
la022005Tg 21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
nch4 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
nch5 21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
nch6 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
sa6682 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa24004 21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa24005 21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa37357 21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
uc42 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
uc50 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
21 94.8 cM fgfr4 Mother of Pearl (MOP) Postlethwait, John H. Data
21 263.89 cR fgfr4 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
21 2832.0 cR fgfr4 Goodfellow T51 (T51) Geisler, Robert Data
21 101.5 cM fgfr4 Heat Shock (HS) Woods, Ian G. Data
21 64.11 cM fgfr4 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
ubtd2 GENE 21 Guyon et al., 2005 Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21  ...
sgcd GENE 21 Guyon et al., 2005 Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21  ...

OTHER MAPPING INFORMATION
Chr 21 Guyon et al., 2005 Guyon JR et al (Exp. Cell. Res 304, 105-115) mapped the sgcd gene to LG21 using the T51 radiation  ...
Markers Encoded by fgfr4
fc13h10 Chr: 21 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1336 TaqI;Tsp509I;NlaIII 36.0
Forward Primer CCTCCAGCTCATGCTCTTCA
Reverse Primer GCTGACCATTTGTCCCAGAA
Genomic Feature uc50 is an allele of fgfr4