| ZFIN ID: ZDB-GENE-980526-436 |
| Gene Name: | retinoid x receptor, beta a |
|---|---|
| Symbol: | rxrba |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||||||
|
| Mapped Clones containing rxrba | |
|---|---|
| BUSM1-12F11 | Chr: 19 Details |
| DKEYP-84F11 | Chr: 19 Details |
| CH73-216M24 | Chr: 19 Details |
| CH1073-247J7 | Chr: 19 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa43215 | 19 | 8,305,473 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 19 | 7,250,339 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 19 | 7,331,414 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 19 | 7,872,875 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 20 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 19 | 50.7 cM | rxre | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 19 | 132.13 cR | rxre | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 19 | 919.0 cR | rxre | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 19 | 37.6 cM | rxre | Heat Shock (HS) | Woods, Ian G. | Data |
| 19 | 12.72 cM | rxre | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by rxrba | |||
|---|---|---|---|
| fb93c09 Ambiguous Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 722 | DpnII | 36.0 |
| Forward Primer | GACACCCCAATCGACACCTT | ||
| Reverse Primer | AGATGCAGCAGGCCAAGAAT |
| Genomic Feature sa43215 is an allele of rxrba |