| ZFIN ID: ZDB-GENE-980526-124 |
| Gene Name: | ndrg family member 3a |
|---|---|
| Symbol: | ndrg3a |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ndrg3a | |
|---|---|
| CH211-25D12 | Chr: 11 Details |
| CH211-274P22 | Chr: 11 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa35087 | 11 | 27,194,452 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 11 | 25,122,422 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 11 | 24,884,806 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 11 | 26,055,981 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 5 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 250.1 cM | ndr3 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| ephb4a | GENE | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. | |
| z34450 | SSLP | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. | |
| zf232 | Feature | 5 | 0.3 cM | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. |
| pax8 | GENE | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. | |
| usp39 | GENE | 5 | Ríos et al., 2011 | Rios, Y. et al.(2011, PLoS Genet. 7(1):e1001271) mapped zf232 (hp689) to the region of usp39 on Chr. 5. |
| Markers Encoded by ndrg3a | |||
|---|---|---|---|
| MGC:63551 Chr: 5 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 126,120 | 36.0 | |
| Forward Primer | GTATAGTAGTGTGTATGAGCATCTGG | ||
| Reverse Primer | AGCTGACCCGCTC(A/C)GGTT |
| Genomic Feature sa35087 is an allele of ndrg3a |