| ZFIN ID: ZDB-GENE-980526-72 |
| Gene Name: | retinoic acid receptor, alpha b |
|---|---|
| Symbol: | rarab |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing rarab | |
|---|---|
| CH211-196P24 | Chr: 3 Details |
| DKEY-242N9 | Chr: 3 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| sa20057 | 3 | 31,877,298 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 3 | 33,069,208 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 3 | 32,937,494 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 3 | 33,206,184 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa20058 | 3 | 31,877,969 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 3 | 33,069,879 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 3 | 32,938,165 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 3 | 33,206,855 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| la015178Tg | 3 | 33,225,179 - 33,225,189 | Zv9 | ZFIN_Zv9 | |
| la015179Tg | 3 | 33,245,756 - 33,245,766 | Zv9 | ZFIN_Zv9 | |
| la024132Tg | 3 | 33,227,345 - 33,227,355 | Zv9 | ZFIN_Zv9 | |
| la024134Tg | 3 | 33,275,879 - 33,275,889 | Zv9 | ZFIN_Zv9 | |
| la028902Tg | 3 | 33,257,278 - 33,257,288 | Zv9 | ZFIN_Zv9 | |
| la015178Tg | 3 | GRCz11 | OTHER_MAPPING | ||
| 3 | GRCz11 | OTHER_MAPPING | |||
| 3 | GRCz11 | OTHER_MAPPING | |||
| la015179Tg | 3 | GRCz11 | OTHER_MAPPING | ||
| 3 | GRCz11 | OTHER_MAPPING | |||
| 3 | GRCz11 | OTHER_MAPPING | |||
| la024132Tg | 3 | GRCz11 | OTHER_MAPPING | ||
| 3 | GRCz11 | OTHER_MAPPING | |||
| 3 | GRCz11 | OTHER_MAPPING | |||
| la024134Tg | 3 | GRCz11 | OTHER_MAPPING | ||
| 3 | GRCz11 | OTHER_MAPPING | |||
| 3 | GRCz11 | OTHER_MAPPING | |||
| la028902Tg | 3 | GRCz11 | OTHER_MAPPING | ||
| 3 | GRCz11 | OTHER_MAPPING | |||
| 3 | GRCz11 | OTHER_MAPPING |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 3 | 75.2 cM | rara2b | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 3 | 51.6 cM | rara2b | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by rarab | |||
|---|---|---|---|
| fj66e06 Chr: 3 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 1068 | DdeI | 56.0 |
| Forward Primer | GAGGGTCTGGAGGGAGGC | ||
| Reverse Primer | GGGGGTCTCTGTGTCTTTCG |
| Genomic Feature sa20058 is an allele of rarab |