ZFIN ID: ZDB-GENE-980526-104

Mapping Details

Gene Name: tenascin Cb
Symbol: tncb
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 5 29,176,065 - 29,305,730 GRCz12tu
NCBI Map Viewer 5 29,176,065 - 29,305,730 GRCz12tu
Ensembl 5 28,561,006 - 28,625,517 GRCz11
NCBI Map Viewer 5 28,561,379 - 28,690,241 GRCz11
UCSC 5 - GRCz11
UCSC 5 - GRCz11
Vega 5 27,960,853 - 28,025,364 GRCv10
Mapped Clones containing tncb
CH73-195I19 Chr: 5 Details
CH211-166O17 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
hu3513 5 29,216,962 GRCz12tu DIRECT Sealy et al., 2025
5 28,601,718 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 28,001,565 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,239,776 Zv9 DIRECT Busch-Nentwich et al., 2013
hu3580 5 29,216,647 GRCz12tu DIRECT Sealy et al., 2025
5 28,601,403 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 28,001,250 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,239,461 Zv9 DIRECT Busch-Nentwich et al., 2013
hu3583 5 29,216,962 GRCz12tu DIRECT Sealy et al., 2025
5 28,601,718 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 28,001,565 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,239,776 Zv9 DIRECT Busch-Nentwich et al., 2013
sa1576 5 29,207,681 GRCz12tu DIRECT Sealy et al., 2025
5 28,592,437 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 27,992,284 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,230,495 Zv9 DIRECT Busch-Nentwich et al., 2013
sa8813 5 29,218,816 GRCz12tu DIRECT Sealy et al., 2025
5 28,603,572 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 28,003,419 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,241,630 Zv9 DIRECT Busch-Nentwich et al., 2013
sa20437 5 29,180,141 GRCz12tu DIRECT Sealy et al., 2025
5 28,565,086 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 27,964,933 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,203,144 Zv9 DIRECT Busch-Nentwich et al., 2013
sa20438 5 29,210,696 GRCz12tu DIRECT Sealy et al., 2025
5 28,595,452 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 27,995,299 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,233,510 Zv9 DIRECT Busch-Nentwich et al., 2013
sa33617 5 29,187,877 GRCz12tu DIRECT Sealy et al., 2025
5 28,572,821 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 27,972,668 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,210,879 Zv9 DIRECT Busch-Nentwich et al., 2013
sa33618 5 29,215,787 GRCz12tu DIRECT Sealy et al., 2025
5 28,600,543 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 28,000,390 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,238,601 Zv9 DIRECT Busch-Nentwich et al., 2013
sa40443 5 29,218,708 GRCz12tu DIRECT Sealy et al., 2025
5 28,603,464 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 28,003,311 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 30,241,522 Zv9 DIRECT Busch-Nentwich et al., 2013
hu3513 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
hu3580 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
hu3583 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa1576 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa8813 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa20437 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa20438 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa33617 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa33618 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa40443 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 83.0 cM tnc Mother of Pearl (MOP) Postlethwait, John H. Data
5 2324.0 cR tenc Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by tncb
fk04d02 Chr: 5 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD MseI 36.0
Forward Primer CGCCAGTAACATTCAAACAG
Reverse Primer CCTGCAGGGGTTGACTCT
Genomic Feature sa1576 is an allele of tncb