| ZFIN ID: ZDB-GENE-980526-280 |
| Gene Name: | distal-less homeobox 3b |
|---|---|
| Symbol: | dlx3b |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing dlx3b | |
|---|---|
| CH73-209K3 | Chr: 12 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa94 | 12 | 6,252,231 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 12 | 5,708,565 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 12 | 5,673,608 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 12 | 6,077,717 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa22023 | 12 | 6,254,869 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 12 | 5,711,203 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 12 | 5,676,246 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 12 | 6,075,079 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| zf3269 | 12 | 5,711,036 - 5,711,039 | GRCz11 | DIRECT | Pang et al., 2020 | |
| sa94 | 12 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 12 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 12 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa22023 | 12 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 12 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 12 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| zf3269 | 12 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 12 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 12 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 12 | 33.0 cM | dlx3 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 12 | 512.0 cR | dlx3 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 12 | 18.7 cM | dlx3 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by dlx3b | |||
|---|---|---|---|
| fb83f11 Chr: 12 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 639 | HinFI | 36.0 |
| Forward Primer | AATCACTGGTACCAGCAGGG | ||
| Reverse Primer | AATGGTTCGAGCACCACC |
| Genomic Feature sa94 is an allele of dlx3b |