ZFIN ID: ZDB-GENE-980526-280

Mapping Details

Gene Name: distal-less homeobox 3b
Symbol: dlx3b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 12 6,252,089 - 6,255,586 GRCz12tu
NCBI Map Viewer 12 6,252,089 - 6,255,586 GRCz12tu
Ensembl 12 5,708,400 - 5,711,920 GRCz11
NCBI Map Viewer 12 5,708,423 - 5,711,920 GRCz11
UCSC 12 - GRCz11
Vega 12 5,673,443 - 5,676,963 GRCv10
Mapped Clones containing dlx3b
CH73-209K3 Chr: 12 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa94 12 6,252,231 GRCz12tu DIRECT Sealy et al., 2025
12 5,708,565 GRCz11 DIRECT Busch-Nentwich et al., 2013
12 5,673,608 GRCz10 DIRECT Busch-Nentwich et al., 2013
12 6,077,717 Zv9 DIRECT Busch-Nentwich et al., 2013
sa22023 12 6,254,869 GRCz12tu DIRECT Sealy et al., 2025
12 5,711,203 GRCz11 DIRECT Busch-Nentwich et al., 2013
12 5,676,246 GRCz10 DIRECT Busch-Nentwich et al., 2013
12 6,075,079 Zv9 DIRECT Busch-Nentwich et al., 2013
zf3269 12 5,711,036 - 5,711,039 GRCz11 DIRECT Pang et al., 2020
sa94 12 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa22023 12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
12 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
zf3269 12 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 33.0 cM dlx3 Mother of Pearl (MOP) Postlethwait, John H. Data
12 512.0 cR dlx3 Goodfellow T51 (T51) Geisler, Robert Data
12 18.7 cM dlx3 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by dlx3b
fb83f11 Chr: 12 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 639 HinFI 36.0
Forward Primer AATCACTGGTACCAGCAGGG
Reverse Primer AATGGTTCGAGCACCACC
Genomic Feature sa94 is an allele of dlx3b