| ZFIN ID: ZDB-GENE-980526-265 |
| Gene Name: | myogenin |
|---|---|
| Symbol: | myog |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing myog | |
|---|---|
| CH211-86H15 | Chr: 11 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| kg125 | 11 | 22,599,343 - 22,599,345 | GRCz11 | DIRECT | Ganassi et al., 2018 | |
| kg128 | 11 | 22,599,345 - 22,599,346 | GRCz11 | DIRECT | Ganassi et al., 2018 | |
| fh265 | 11 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| kg125 | 11 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| kg128 | 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 11 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| myog_unrecovered | 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 11 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 11 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 11 | 86.4 cM | myog | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 11 | 237.01 cR | myog | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 11 | 1810.0 cR | myog | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 11 | 43.1 cM | myog | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 485 | HinFI | 36.0 |
| Forward Primer | AGGATCTGCTGAACGACGAC | ||
| Reverse Primer | CAAGACTGGCATTCGGAACT |
| Genomic Feature fh265 is an allele of myog |