| ZFIN ID: ZDB-GENE-980526-485 |
| Gene Name: | POU domain, class 5, transcription factor 3 |
|---|---|
| Symbol: | pou5f3 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing pou5f3 | |
|---|---|
| CH73-205E12 | Chr: 21 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| e713 | 21 | 13,687,101 | GRCz11 | DIRECT | Burgess et al., 2002 |
| hi349Tg | 21 | 13,689,438 - 13,689,439 | GRCz11 | DIRECT | ZFIN Curated Data |
| hi1757Tg | 21 | 13,692,718 - 13,692,719 | GRCz11 | DIRECT | ZFIN Curated Data |
| hi1940Tg | 21 | 13,690,021 - 13,690,022 | GRCz11 | DIRECT | ZFIN Curated Data |
| ihb137 | 21 | 13,689,976 - 13,689,979 | GRCz11 | DIRECT | Zhang et al., 2020 |
| ihb893 | 21 | 13,689,972 - 13,689,976 | GRCz11 | DIRECT | Wang et al., 2023 |
| ihb934 | 21 | 13,689,975 - 13,689,981 | GRCz11 | DIRECT | Zebrafish Nomenclature Committee |
| ihb935 | 21 | 13,689,956 - 13,689,980 | GRCz11 | DIRECT | Zebrafish Nomenclature Committee |
| m216 | 21 | 13,687,101 | GRCz11 | DIRECT | Belting et al., 2001 |
| sa1294 | 21 | 15,087,197 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 21 | 13,687,075 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 21 | 13,590,346 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 21 | 11,889,172 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa1329 | 21 | 15,090,554 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 21 | 13,690,432 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 21 | 13,593,703 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 21 | 11,892,529 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sud25 | 21 | 13,690,395 - 13,690,401 | GRCz11 | DIRECT | Yuikawa et al., 2023 |
| la013973Tg | 21 | 11,890,655 - 11,890,665 | Zv9 | ZFIN_Zv9 | |
| e68 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| e713 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hi349Tg | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hi1757Tg | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hi1940Tg | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ihb137 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ihb138 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ihb893 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la013973Tg | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| m216 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| m308 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| m793 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| pou5f3_unspecified | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| sud25 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| wi270Tg | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| zf3267 | 21 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 21 | 57.8 cM | pou2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 21 | 1331.0 cR | pou2 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 21 | 50.3 cM | pou2 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by pou5f3 | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| chunp6868 Chr: 21 Details | ||||||||||||||||||||
| fd18d06 Chr: 21 Details | ||||||||||||||||||||
| Genomic Feature m793 is an allele of pou5f3 | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||
| Genomic Feature e713 is an allele of pou5f3 | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||
| Genomic Feature m793 is an allele of pou5f3 | |||
|---|---|---|---|
|
| Genomic Feature e713 is an allele of pou5f3 | |||
|---|---|---|---|
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 796 | BfaI | 36.0 |
| Forward Primer | GCCCTTTGATGACGAGTGTG | ||
| Reverse Primer | TTGGAGATGGGAGAGTGCAA |
| Genomic Feature hi1757Tg is an allele of pou5f3 |