Genomic Feature

w2

ID
ZDB-ALT-990423-22
Name
w2
Synonyms
  • (part of) Casper fish (1)
  • (part of) Crystal fish (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
David Raible Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 6: 43429185 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T at position 417 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gln>Stop at position 113 (1)
Sequences
Flanking Sequence
ATAAAAGTTAAGCATAAAAACAAATATTTTAATTCAAAACAAAAGAAAAAAGAGTGCTCAGCCAAGTTACCTAAGATTGTAATCAAAGCAAAAGACAACAACTATCAATTAAAAATAAAATAGTTACTCTGTGATGTTAAAATAAAACTACACCAAACATGCATGCCGAGGCCTGTTAGCCATCAAAAAAAAAAAAAAAAAAAAAAGTTATGTAAGTCTAAATACTTTCTCACTAATTCTTCAGAGAGATGCTATCTTGTCTGTGACTGATTGATAATGGATGTGTGGATTGAGGTTCCCTTCATGAGTGCAGGTTAATACAGATATAGGTCTGATTAGTATTTTGGCACCTAAGCATTAATTACAAGATGACACCAAATAACTACTGTACATTCTTCTTTCATTTAAATTTGTTACAGATGGACGATGTAATTGAAGACATTATAAGTTTGGAATCAAGCTACAGTGATGACATTCTTGGGTTCATGGATGCAGGACTT
C/T AAATGACAAACACGGTAATAGCCTTAAGTATGATACGAACATTAGAATCATGCACATTTGTTTCAGTTAAGATAGCCTGAACAATCAGCACATGCAAATAATCATTTATTATTTCTCAGATTCCAGTTTCAGCAAACCTGCTGGACATGTACAGCAATCATGCTCTTCCTCCAGCTGGAGTTTCCATCAGTAACTCCTGCCCCTCAAGCCTGCCGGCCGTCAAAAGGGAATTATCCGGTATGTATTCACATTGTCTTGTTTACCATTGGAGATTACAATAACGTTTGAGTTTAAATGTCCAAGCTCACCATGCTGAGGAATAGAAGTGTTCATATTGGGTGCAGTAATGAATGCACAATATCAATCAAAGATGTATTATATTATTCAATAGTTACTCCATCTCCGGGCATGATGCACATAATGGACAAAGCTGGACCATGTGGCAAGTTTGACTCTTATCAAAGACCTGATGGCTTTCCAGTAGGTATGTTTTCCTTTTC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations