Genomic Feature

tm317b

ID
ZDB-ALT-980413-508
Name
tm317b
Synonyms
  • AM117B (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 7: 29014022 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
A missense mutation changes an asparagine (AAC) to lysine (AAA) at amino acid  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Asn>Lys at position 172 (1)
Sequences
Flanking Sequence
GCACTGCAAGAAAAACAAACTGTACCTGACACCAAGGCTGAATGACACACTTTATCTTCACTTTAAAGGTTTGAAATTGCTTAAACAAAAGAGACTAATTTTGCATCTTCATCTTTCTTTTCAACTTTTTTAATGAAACTGTTAATTCTCCATTGTAGGTTTTTCTTGTATAGAGGGTTTGGAAGAATATACTGGCCTGCGCTGCCTATGGCTCGAGTGTAATGGTATTCGAAAGATTGAAAATCTGGAGAATCAGACAGAGCTTCGCTGTCTGTTCCTCCATCAGAATCTCATTCACACTCTGGAAAACCTGGAACCACTCAGCAAGCTTTGCACGCTTAATGTCTCAAACAATTATATCAAGGTCATTGAGAACATTTGTAAGTACTTAACTCATTGTCAAACTTTGGCCCCAGTCTTTCATTCTCATTTATTTACACATTAAGGTTTTGTTTTTCAGCTAGTTTGAGCGACTTGTCCACTCTACAGATCTCTCATAA
C/A ACACTGGAGAATGTTTGTGACATGGAGGAGCTTTCACACTGTCCATCCATCAGTGTCCTTGATCTGTCCCACAACCGCATCAGTGATCCAGCGCTAGTTAATATTCTAGAGAAAATGCCTGACTTGGTAAATTACAGTGCATTTCTTTCCTCATTTATGCTTTCTTGTAAATTTTGATTAATTTGCTAGTTAATATATGTTTGCTTGATCTTTCCAGCGGGTGTTAAATCTAATGGGCAATGAAGTCATCAAAAAAATCCCAAACTACAGGAAGACTCTGATTGTGCGTCTGAAGCAGCTGACCTATCTAGATGATCGGCCTGTTTTTCCAAAAGATAGGTTAGCAGCAGTGTTTACTGTTTAAAAATTAGCATTGTCAGATTTTTATCTGCAGTTTTCTCCACAAAGCTTATATGTAACCCGTTACTCTAAAGCAGGGGTCCCCTAACTCAGTCCTGGAGGGCTGGTGTCCTAGCTCCAACCCCAATTAGACACACCTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations