Genomic Feature

m610

ID
ZDB-ALT-980203-632
Name
m610
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (2)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
Comment Citation
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ... Holzschuh et al., 2003
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 24: 8723081 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G (1)
Transcript Consequence
Cryptic Acceptor Splice Site, Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GGCAGATCTGTACTCCTTTCATTGGCACACTGCTTTACTGATTTAGAGAAGTGCATTGTCCGCAAATCCCAGAATTAACTGTGTGTTTTATTAATTAAAAAAAAACTAAATGCCAAGATCGGAAGGTGGTGGGTTCAGTGTTTCATCTTGATCACTAGTGTGTTTGTTATATGTAGTTTGTCATATTAGTTGGGAGGTGGTGGTTGGATATCACTTTCTGTGCTTCTCATCTTTGTCACCCGCTTTCGACCCCGTCTCACTGTGGCTGTTGGGATTGTTGTTCAGGTACATTTTGTCCATTGCTTTAATTGCCTCCGTCAGATAGTTCTGCAGAGCTGTGAGGGCCGCACAGACGGCCGGAGTTCCGAATCCGTGAGAAATAAGACTGAAGTGGGTCAAACAGCTCTGAATCCCGGGCTCGAGAATGGGTTGTGGACGTGAATTCCCCAAGGGCGAGCGGTCTTGAGACAGCAGGTCCGTGAACTCTTTGCAGATTTGTC
T/C AGAAGGAGACACAATGCAGGATGCGTGTCAGGAGGAAGCTAATTACAGCTGATGCTATGACGTCATACATGTATTAGTAAGACTATGTGGTCCATATGTGTCCTTTAATCGATGACACACGTATTCCGTTTGACAGTAGCTGGATGGGCAGTGTCGTGTCATAGCGATGGACAATTCACGTTCAGCTTAAGAGAGCCGCATCTATGTCAGAAACGGATGAGGGAGTCGTCTTGTATGTTTTTATTCTAAATCGTTGTTGTTTGCAGTCTTATGTGTTTTAATTGACACTGGTGCTGATCTTTTTTATTTAAACTTTTTTTTTTTTTATTGCATCAAATATGCCGATATATTTCATTGCAGAAAGCATACCGTTTCGTGGAATATTTGAAATATACTTCATAAAACCAAACGGCTCCAAAAAGCAGGAATTAAACCAGCTCTGTTTATTAAAATCTAAATGTAACAAATTTTTAGTACACGTATAGGCGATCCAGCATAAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations