ZFIN ID: ZDB-ALT-980203-632
Genomic Feature: m610
Synonyms:
Affected Genomic Regions: tfap2a
Type: Point Mutation (2)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 24: 8723081 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Cryptic Acceptor Splice Site, Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GGCAGATCTGTACTCCTTTCATTGGCACACTGCTTTACTGATTTAGAGAAGTGCATTGTCCGCAAATCCCAGAATTAACTGTGTGTTTTATTAATTAAAAAAAAACTAAATGCCAAGATCGGAAGGTGGTGGGTTCAGTGTTTCATCTTGATCACTAGTGTGTTTGTTATATGTAGTTTGTCATATTAGTTGGGAGGTGGTGGTTGGATATCACTTTCTGTGCTTCTCATCTTTGTCACCCGCTTTCGACCCCGTCTCACTGTGGCTGTTGGGATTGTTGTTCAGGTACATTTTGTCCATTGCTTTAATTGCCTCCGTCAGATAGTTCTGCAGAGCTGTGAGGGCCGCACAGACGGCCGGAGTTCCGAATCCGTGAGAAATAAGACTGAAGTGGGTCAAACAGCTCTGAATCCCGGGCTCGAGAATGGGTTGTGGACGTGAATTCCCCAAGGGCGAGCGGTCTTGAGACAGCAGGTCCGTGAACTCTTTGCAGATTTGTC
T/C
AGAAGGAGACACAATGCAGGATGCGTGTCAGGAGGAAGCTAATTACAGCTGATGCTATGACGTCATACATGTATTAGTAAGACTATGTGGTCCATATGTGTCCTTTAATCGATGACACACGTATTCCGTTTGACAGTAGCTGGATGGGCAGTGTCGTGTCATAGCGATGGACAATTCACGTTCAGCTTAAGAGAGCCGCATCTATGTCAGAAACGGATGAGGGAGTCGTCTTGTATGTTTTTATTCTAAATCGTTGTTGTTTGCAGTCTTATGTGTTTTAATTGACACTGGTGCTGATCTTTTTTATTTAAACTTTTTTTTTTTTTATTGCATCAAATATGCCGATATATTTCATTGCAGAAAGCATACCGTTTCGTGGAATATTTGAAATATACTTCATAAAACCAAACGGCTCCAAAAAGCAGGAATTAAACCAGCTCTGTTTATTAAAATCTAAATGTAACAAATTTTTAGTACACGTATAGGCGATCCAGCATAAG
(1)
Comment Citation
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ... Holzschuh et al., 2003
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ... Holzschuh et al., 2003
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ... Holzschuh et al., 2003
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ... Holzschuh et al., 2003
OTHER m610 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous tfap2am610/m610 tfap2a ♀+/- ♂+/-
tfap2am610/m610 (AB) tfap2a Unknown
Heterozygous tfap2am610/+ (AB) tfap2a Unknown
Complex tfap2am610/m610; foxd3m188/m188 foxd3, tfap2a
tfap2am610/m610; foxd3m188/m188; vu17Tg; vu234Tg foxd3, tfap2a

CITATIONS  (12)