ZFIN ID: ZDB-ALT-980203-609
Genomic Feature: m294
Synonyms:
Affected Genomic Regions: ndr2
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 12: 48211856 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Cys>Arg (1)
FLANKING SEQUENCE (GENOMIC)
TCCAGAATAGACCCCGGAGACCATCAGCAGCCCCTAAAGGACAGGAGCTCCAGAGCAGGCCCAGCAGACCAGCGACAGCTCCTAGGGGACAGGAGCTCCAGAGCGCACCCCAGCGGCCAGTAGTGGCCCCTGGGGGTCGGGAGATTCATAGCAGGCCCTGGTTGCCAGCAGCAACCCCTGGGGGACAGGAGATCCAGAATGGGACCCAGAAACACAGAGCCATGCTGCTGCTGTTTTCAGAGCAGCAGGACGGGGCCAGTCTCCTACACACCGCCGGGGCCTCGAAGTTTCTGTTTTCTAGAAATAAGAAAGAAGTCAAGCGAGGACGGGCCCTCAGGAGCCGCAGGGGCCGCCGGGGGCCACCTGTCAGGAGCCCAGAGCTGCAGAGAACACCACTGCACAAGAGCACCACCTGCAGGAGGGTGGACATGCATGTGGATTTTAACCAGATCGGATGGGGCTCCTGGATCGTGTTCCCTAAGAAGTACAATGCATACCGG
T/C
GCGAGGGGGCCTGCCCGAACCCACTGGGAGAAGAGCTGCGGCCCACCAATCATGCATACATGCAGGTACTACGGTATATGTGTAAATATAACTTTAAATACATGGATAAATGTGTAAATGTTAATTATTTTAAATTAATCTGGCTTTCAATAAAATATAAGCTAATTAGCATTTTTAAAAGTAGATTTAAATAGTTTAAAATATTTATATTAAATATTTTGTAATGGCATAAAAATAGGTAGATAAGAATATAAATAATAATTGTTTGAAATAAAAGTTGCTTTAATTTAAATTTATATTAATTAGCATTTTTAACTGATGTGAAAAATTAAAGCTCAAAAATATTTATAATAAAACAACATAAATAAATGTAGAAATATTAAATAAAATGTAATTTCAAATAAATCTAAAACTATAAAACTAAAACTAATACAAGATTGTGTTACTATAATGTTATACAATTTATAGATAAGCATAAATTTATAAAATAAAAATTTATA
(1)
NOTES
Comment Citation
A mutation in the second cysteine of the mature ligand region. Sampath et al., 1998
OTHER m294 PAGES No links to external sites

CITATIONS  (44)