Genomic Feature

m139

ID
ZDB-ALT-980203-477
Name
m139
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 11: 30600204 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Arg>Stop at position 400 (1)
Sequences
Flanking Sequence
TGTACGTACCACCTTCACCTCCATCATGCCAATGCTTTCACTGATATGAACAATTGGTTCCTCAAATAAGAAGATGCCAGCATGGTCATCATCAAAGATAGTCACGGTAGCTGTTGAAGGAAGGCCAAGACCAGCTAAAGCGTCCACATGATTGGTACCTGGGTTTCCATTGTTGGCTCCTTCAGATATGACCTTGACATTGCTGAGATGAACCAGGAAGTGTTCATCTTCTTCAAATATATCATCGTCGATAATGTCCACTCTAATCTCCTTTTCGGTCTCACCTGGTTTGAAGATTATGACACCCTCAGTGAACTGGTAATCAGAACCTGCATTGGCAGTGCCATCCTCAGTTCTGTACTCCACTGACACAGTGCTGGTTAAGTCGCCGCCGCGTCGAACCACGTTCAAAGCCACAGTTCCACAGTTCTCCAAACACTGATATGTCCCAGGGTCGAAGAAAATCTTGGAGGAGATATCATTATCGGAGACTTCCGATC
G/A AAGTTCATGGATACCAAGTGCTTTTCTGGCTTGATCTGCAGCATGTTTCTTCAGTATATTTCCTGCACCAGTCATAAGTCTAGTGGCCTGACAGCGATAGAAAGCACGGCTCTTCTGTTGCTGGCTGAGGACGTGGTAGTTGGCAAGCTCAACAAGCTGCTCCATCTCCTTTTCCGGATGCTTCTGTTTCAGTTCCTTCAAAATCTTGGCCATTTCCCTTCTGGCCTCGTCCTCATCCGCGTCTTTATCTTCATTATCAACTGCGCCGTCTAAAAACTCCTCGGCATGAGAGTTAAGCATCCCGCCATCCATTTCGATATCAGCCTTTGACTGGAGTTCTGGTTCACCTTCAGTCTCTATAATTATCCCACGTTTCTTTCCAACTCTGTAACGTTTATACACGTATTTGTAAAACAGAAGTCTACGGTCTGCAACCCAAGCAAATAATACACAAATAGGAAAGAAAAACAGAGTAAGAAGTCCCTCCCAGACCTCCACGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations