Genomic Feature

n1

ID
ZDB-ALT-980203-470
Name
n1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
spontaneous 
Lab of Origin
Jowett Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 13: 14976378 - 14976379 (GRCz11) (1) Details
Nucleotide change
CC/-
Variant Notes
2-bp deletion
Two C residues at positions 211 and 212 of the wild-type coding sequence are  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
2 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
TTTCTGGACTACCTCCGGGGGCATGTAGCGCAGAGGGCCATTAGGATATTTGACAATCTCAGCTTGTTACAACTCCATCAGTTAATTGGATCCCTTGTAGAGCCGCTCGTTTGACTCATCTGCCACTTAAAAATACAAAGGCGCGCTGGGGGTCGTTCACACCTCGCGCCCTAGAGCAGGTATAAAAGACCCGCTGCCTCACCAACTTCATTCCACTCCTGATATTAGGGTCGAGAACTTCGAAGGATATCTTTTTTTTTTTTTAGTTGCTTTTTGGACTAAACAGACGCCATGCAGATTCCCGGAAGAGCTTACGAAACTTATGGACAATCAGCACGTCCTTTGCATCAGGACTATGCCACCTCTTCTTCAAAACCGAGCACCGGGAAATCATTCACCATAGACGCTCTGCTCGCGAGGCCTGACCAGGCGGAGATGAGAGAACGAACAAACGCGTACCGGAGCATAACCAACCAAACGTCTGTCTCCAGCTCTGCGCT
CC/- CGCTTATTTACTCGCAGATGCCACACTTCGCGTACAGCCAAAGCATCATGCAAACTCAGACAGGCTATCCCGTGTTCTGCTATCCGCCCTACAACTTCCAAACAACATGTCGTGGAGCTGTGTACGCACAAGGTATAAAGGCTAGGTTTTAATGAATGTAGCTAAGAATAGAAATTATTTTAATGATACTTCAAATATGATTTCCTAACCAATGCGTTCTTTTGTTTTTCGCACCCACAGATGCAGTACTGGCGAAAGCAGCAGTTCATTCTCATTATAAACACAAATCTGGGAAATCAAAGCGAATGCGTACAAGTTTTACCAACGATCAGCTGTCCAGACTGGAGAAAGAGTTCGCGCGGCAGCAATACATGGTGGGATCTGAACGCTTTCTGTTGGCATCTGCTCTCCAACTCACTGAAGCTCAGGTAAATAAATTACATGGTATGACAAAATTTTAGATTGACTTTTGCTTTCGGTTTAATTCCAAATATGTACAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
n1.pdf
Citations