Genomic Feature

m145

ID
ZDB-ALT-980203-418
Name
m145
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 39589568 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
m145 consists of a T to A transversion that changes the stop codon to Gly and  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Elongated Polypeptide: Stop>Gly (1)
Sequences
Flanking Sequence
CCCCCCAAACAAACAGTAGTGATTGAAGTGCATCATACCAATGAACTAATTTCAATATAAACTCTAGTTACAATCTTACACATGTACAGATTTACAAACTGGATTGTTAAATCAGAGATAAAAAAACAAACACCTCACTTTAGTGATTATCTGCAAAACTTTGGTTTGTTTCAGAACAAGCTGTTCACTCTAAAGCTGCTGTTGGGTGTTTGTGGAAGTCAGATGATATCAAAGCATACATCTCAAATGCAGCATGTTAGCAGTGTTTATGCAGGCACTGTTAAAACAGAAACAAACTTCCTTTACGGTTTCCAACACAGTGCGACGTGTAAAAACTCTTTCTTTTCTTCCCAGAATGTTGGCTTAAGTTTGACGCTGCATATGTGCACAAGTGTAGAGGAAGACAAAAGCCCATGCTGCTGACCGAAGCAGGCACAATAGCCGCTGCTTTCCTTTATGTACAAAGCATGGAAGACGTCCAACATTTAAATCCAACATTT
A/T AAACGCTCCCACTTCAGTTCCCCACGGTCGGTATGGTTTACTGCTGCTCCCGCTGCTCTGTTGGGATGTGGTGGATGTGGAAACGGAAGAGCTCACGGTGGAAGAAGCCACTGAAGATGCTGTAACGCTGGGGCTGAAGAGTGGGAATCCAGCGGGAAATGATAGAGGGAAGGTTTGAGCTGCAGCTGCAGCAGCTGCTGCGTGAACGGTCGCTGATAACGAAAGCAGAGAAGTGGACAGCGGTGGCACGCAAGGAGCCACACTTCCAGTAGAGGGCGCTCTGAGTGCCGAGTCACTATGGGAGAAAAGGGCTGCACCTCTTTGAGGAGCCTCAGACAGCCTGCCGGAGGAGCTCTCTGAGGAGGGAAGTCCGCTCTGCTGCAGGAACGCAGCAGGAATGGGATGCAAAGCGGCAGCCCAGTGGTGCGGGTGAAGGGCCTGCTGGTGATGGGCTATGGATGTGGTCATGGCGGCTGCTTCCCTCTGCGAGGCACAGCTGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations